N-Terminal Pro-Brain Natriuretic Peptide (NT-ProBNP)—a Biological Marker of Heart Failure

Cloud-Clone Corp.

N-Terminal Pro-Brain Natriuretic Peptide (NT-proBNP) is synthesized by heart muscle cells, after secreted into the blood, it will be decomposed into BNP (the concrete introduction of the BNP, please pay attention to BNP - important markers of heart failure) and NT-BNP by endoproteinases (figure 1). As NT-BNP is characterized by non-biological activity, long half-life in the body, and easy to track for a long time, so it can be used as a clinical marker for cardiovascular disease surveillance, and cardiovascular researchers at home and abroad show great interest in it. In 2004 and 2008, the international experts systematically elaborated characteristics and clinical applications of BNP and NT-proBNP. In recent years, the tests of NT-BNP are also gradually widely used in the clinic by domestic hospitals. As a biological marker of heart failure diagnosis and accession, NT-proBNP is recommended to be applied in heart failure diagnostic and prognostic judgment in China in The guide of chronic heart failure diagnosis and treatment (2007) and The guide of acute heart failure diagnosis and treatment (2010).

Based on the important roles NT-proBNP plays in the heart failure surveillance, Cloud-Clone Corp. has been paying attention to it, and its associated products were also developed, the development of specific products is introduced as follows.

First, we use a high-flux expression system to express recombinant NT - proBNP. We chose the mRNA sequence encoding NT-proBNP according to the NCBI NM 002521 CDS (the nucleotide sequence encoding NT-proBNP), and added termination codon (TAA) to the C-terminal end , and then this sequence was used as the template to design primers.

[PRIMER INFORMATION]

Upstream Primer: CGGAATTCCACCCGCTGGGCAGCC
Downsream Primer: CCGCTCGAGTTATCGTGGTGCCCGCAGG

 After completing the design of primers, 231bp DNA sequence was obtained by PCR . After that, the PCR product was verified by gene sequencing, then this gene was cloned into self-established E.coli expression vector pUSCNK-2 by traditional cloning procedures, and the plasmid was used for expression of the protein, The result of sequencing is shown as follows (Figure 2).


1        CACCCGCTGGGCAGCCCCGGTTCAGCCTCGGACTTGGAAACGTCCGGGTTACAGGAGCAG
61      CGCAACCATTTGCAGGGCAAACTGTCGGAGCTGCAGGTGGAGCAGACATCCCTGGAGCCC
121    CTCCAGGAGAGCCCCCGTCCCACAGGTGTCTGGAAGTCCCGGGAGGTAGCCACCGAGGGC
181    ATCCGTGGGCACCGCAAAATGG TCCTCTACACCCTGCGGGCACCACGATAA

Figure 2. Result of human NT-proBNP DNA sequencing


Then, IPTG was used to induce the expression of recombinant NT-proBNP in vitro, after the recombinant protein was purified through Ni-chelating affinity chromatography, we got the recombinant NT-proBNP protein with molecule weight of 12.3kd (RPA485Hu01) .The protein sequence is shown in Figure 3.

MGSSHHHHHH  SSGLVPRGSH  MASMTGGQQM  GRGSEF-HPLG  SPGSASDLET  SGLQEQRNHL  QGKLSELQVE  QTSLEPLQES PRPTGVWKSR  EVATEGIRGH  RKMVLYTLRA  PR

Figure 3. The protein sequence of NT-proBNP


The SDS-PAGE experiment shows that the purity of the recombinant protein is more than 95%, and the result of SDS-PAGE is shown in Figure 4. Then, purified recombinant protein was used to immune mice for, monoclonal antibody preparation. Followed by purification by Ni-chelating affinity chromatography, high specific and purified antibody was obtained. At the same time, we also prepared polyclonal antibody to human NT-proBNP (PAA485Hu01) by immuning rabbits.

The purity and specificity of purified antibody were vefiried by western blot, and the result is shown in Figure 5. 

Cloud-Clone Corp. uses high-purified protein and high specific antibody as raw materials to produce ELISA Kit for N-Terminal Pro-Brain Natriuretic Peptide (SEA485Hu) and CLIA Kit for N-Terminal Pro-Brain Natriuretic Peptide (SCA485Hu).

These two ELISA Kits will provide a good technology tools for scientific research and make it convenient to quantify NT-proBNP content accurately in biological samples. Detailed information of the products are shown in figure 6, the scientific researchers can choose relevant products according to their demands. 

For more information, please check www.cloud-clone.com or Download

NT-proBNP--a Biological Marker of Heart Failure