New bio-marker for tumor - Anterior gradient protein 2 homolog (AGR2)
Anterior gradient protein 2 homolog (AGR2), a secretory protein localized in the endoplasmic reticulum, which was primary expressed in the trachea, lung, stomach, small intestine, colon and prostate. As it closely interacted with Mucin 2, ARG2 has been frequent mentioned in tumor related researches.
Cloud-Clone Corp. has developed ARF2 protein, antibodies and series ELISA kits for researchers. AGR2 protein is encoded by 175 amino acids. After epitope analysis of functional domains, full length protein (Arg21~Leu175) excluding signal peptide sequences were chosen as the immunogen. This sequence retained whle antigenic epitopes, which would also be more convenient for researchers to conduct functional researches. Base on the corresponding protein and nucleic acid sequences (O95994) retrieved from uniport, the primers were designed as follow
[ PRIMER INFORMATION ]
Upstream Primer: CGGAATTCAGAGATACCACAGTCAAACCTGGAG
Downstream Primer: CCGCTCGAGTTACAATTCAGTCTTCAGCAACTTG
EcoRI and XhoI restriction sites were introduced for recombinant vector construction perspective.
450bp sized DNA fragments (figure 1) were obtained via PCR reactions. After sequencing, this fragment was constructed into Cloud-Clone Corp. created E. coli expression vector pUSCNK-1 through restriction enzyme digestions and ligation following routine procedures.
This sequence was turned out 100% identical to AGR2 gene (homo) from NCBI data base(figure 2).
Thereafter, the recombinant pUSCNK-1 vector was transformed into E. coli for expression. A 17KDa fusion protein was produced through the induction of IPTG. As this protein was fused with His tag, it was purified through nickel column purification (figure 3, order no: RPC285Hu01).
Then, mice were immunized with purified protein to produce AGR2 mouse anti-human monoclonal antibody (MAC285Hu21), while immunization of rabbits to get rabbit anti-human AGR2 polyclonal antibody (PAC285Hu01). Highly specific antibodies were obtained through affinity chromatography purification method
After obtaining purified antibody, its specificity to AGR2 was verified by Western Blot and IHC. The results shown in Figure 4&5. In Western Blot, the human colon, small intestine, stomach tissue samples showed positive, and rat muscle tissue samples showed negative, so it proved the specificity of AGR2 expression(figure 4) .
Then, purified monoclonal antibody (MAC285Hu21) was FITC-labeled to make AGR2 protein labeled anti-human antibody (MAC285Hu81), and used IHC test on gastric cancer tissues. Fluorescence microscopy results were shown in Figure 6. The results show that there is a strong fluorescence signal in human gastric cancer tissues, and the signal is mainly concentrated in the cytoplasm, thus proving the specificity and efficiency FITC-labeled antibody.
Meanwhile, Coud-Clone Corp. can also provide corresponding AGR2 protein assay kit (SEC285Hu).
For more details, please check www.cloud-clone.us.